| |
Clinical Picture
The myotonia and weakness tend to gradually progress over several
years and vary from person to person. Weakness in facial muscles
is often noticed first, resulting in lack of facial expression
or a mask-like appearance that has been called “myotonic
faces.” Weak muscles may result in dysarthia (slurred speech)
and ptosis (droopy eyelids). The range of symptoms associated
with MMD is classified into three main types of MMD. Because
MMD greatly varies in severity between individuals and within
a family, not everyone affected has the same symptoms or same
degree of disease severity.
•The mild type is characterized by mild myotonia,
cataracts, balding, and the potential for diabetes. The age
of onset for this type is generally in adulthood, and these
individuals have a normal lifespan.
•The classical type of MMD is characterized by muscle
weakness and wasting, myotonia, cataracts, balding, and the
potential for heart problems and diabetes. This type is usually
recognized either in childhood, adolescence, or adulthood. The
lifespan may be slightly shortened. Generally, the earlier the
symptoms present, the more severe the disease is.
•Individuals with the third type of MMD, or congenital
MMD, have severe disease. Their symptoms often begin at
birth and can include significant weakness, myotonia, breathing
and swallowing difficulties, and often mild to moderate mental
retardation. This type can be life threatening and almost always
occurs when a baby is born to an affected mother.
Childhood and Adult Onset Myotonic
Muscular Dystrophy
When MMD symptoms begin in adolescence or adulthood, often the
condition is only moderately disabling with slow progression.
Several different parts of the body may be affected.
Limbs: Weakness in the voluntary muscles of the
arms and legs is present because the muscles often shrink.
The distal muscles, those farthest away from the trunk of
the body, are affected first. Muscles closer to the trunk
(proximal muscles) may or may not be affected later in life.
The distal muscles include those in the forearms, hands,
lower legs and feet. People with MMD often notice trouble
with their grip and may have problems with tools and writing
utensils. Modern technology has introduced assistive devices
for the hands and arms to help hold a good position for
using a keyboard, writing or drawing. Braces for the legs
and wheelchairs help when foot and leg weakness is present.
Head, Neck, and Face Muscles: Weakness and loss
of muscle bulk, especially in the temple area, leads to
a characteristic long, thin facial appearance. Also, the
eyelids may droop (ptosis). Weak neck muscles can impact
sitting up and lifting one’s head.
Breathing and Swallowing Muscles: If respiratory
muscles become weak, lung function may be affected. This
may lead to the tired feeling that some individuals with
MMD have. Also, an abnormality in the area of the brain
that controls breathing may cause further respiratory difficulties.
This can lead to sleep apnea, where people periodically
stop breathing while they are sleeping.
Swallowing requires some voluntary and some involuntary
muscles, and both can be affected in MMD. Choking can occur
if swallowing muscles are weakened.
Myotonia: When the voluntary muscles are myotonic,
it can make it difficult for someone with MMD to relax their
hand and finger muscles. This can pose a problem when they
try to use door knobs and writing or eating/drinking utensils.
Myotonia is often more severe in colder temperatures and
can affect other muscles, but it is usually not apparent.
The Heart: In later-onset MMD, the heart conduction
system may be affected, resulting in arrhythmia.
Organs: As a result of muscle weakening and myotonia,
people with MMD may have abnormal function of the involuntary
muscles that surround the organs. This can affect the digestive
process, including swallowing and gallbladder processes,
and can cause cramp pain, constipation, and diarrhea. A
special diet and other treatments can help to manage bowel
problems.
In people with MMD, the gallbladder may weaken which may
lead to gallstones. Symptoms of gallstones include difficulty
digesting fatty foods and pain in the upper abdomen. Surgery
is available when necessary.
Women with MMD may have complications during childbirth because
of weakness and uncoordinated action of the uterine muscle
wall. This can be harmful for the mother and the baby and
may necessitate a Caesarian section (C-section). All surgery
must be performed with care since individuals with MMD may
have anesthesia complications. Surgery can usually be safely
performed with very careful attention to heart and lung functions.
The entire medical team must know of the patients MMD condition.
Brain: Sometimes people with MMD are appear slow
or depressed. It is important to remember that people with
MMD have a variable or nonexistent level of mental and emotional
symptoms. Children with the congenital type have more severe
learning problems and potential mental retardation, whereas
in adults, severe mental impairment is rare, but social
or occupational challenges may be present.
Eyes: People with MMD are at risk for developing
cataracts, a visual interference involving clouding of the
lens. They are extremely common in MMD. Symptoms include
blurred vision, or a hazy appearance that gradually worsens.
Both eyes may be affected, but not always at the same time.
The muscles that control eye movement m can be affected
in MMD. An ophthalmologist should be consulted to treat
any eye problems and the individual should have periodic
eye exams.
Diabetes: Individuals with MMD may develop high
blood sugar caused by mild insulin resistant diabetes. In
this type of diabetes, the body makes insulin that doesn’t
function properly. Insulin-dependent diabetes can be tested
for easily, and treated with a special diet, exercise, and
possibly medication.
Anesthesia: People with MMD seem to have an unusually
high rate of complications and even deaths associated with
general anesthesia given during surgery. Anesthesia complications
can occur regardless of the severity of MMD.
The above information is adapted from the MDA web site. For
a more detailed review of the symptoms and complications involved
in MMD, visit the MDA web site at www.mdausa.org.
Congenital Myotonic Muscular Dystrophy
This is the most severe type of MMD. Babies born with congenital
MMD do not have myotonia, but they do have have very weak muscles
and low muscle tone, called hypotonia, which makes them appear
floppy at birth. Feeding may be difficult for these children
due to poor suck and swallowing. They may also have difficulty
breathing. Medical technology, such as artificial ventilation
and feeding tubes, is allowing for children with congenital
MMD to have a better chance of survival, but these children
still have medical difficulties in childhood, and myotonia often
develops later in life. Mental retardation is generally present,
however, children with congenital MMD can learn if given the
right environment and tools. Problems with speaking, hearing,
and vision are other symptoms that children with congenital
MMD may face. There is treatment for such symptoms and affected
children can get help from speech-language pathologist and early
intervention programs.
What Causes Myotonic Muscular Dystrophy
Almost always, a child born with this type of MMD has a mother
with adult-onset MMD, even though her symptoms may be so mild
that she was never diagnosed officially with the condition.
Mothers with MMD can also pass on the less severe forms of this
muscular dystrophy. When fathers with MMD have children, the
child can inherit the disease, but it is most often the adult-onset
form. This is a genetic feature seen only with this type of
muscular dystrophy.
MMD is caused by an autosomal dominant mutation in a gene on
chromosome 19. The gene that is affected is the DMPK gene, which
codes for a protein that needed for a person's muscles and body
to be healthy. Chromosome 19 is an autosome (chromosomes 1 through
22), or a non-sex chromosome that both males and females have
in common. This means that, unlike Duchenne and Becker Muscular
Dystrophy, both males and females are equally likely to inherit
a genetic alteration that leads to MMD. Autosomal dominant inheritance
is characterized by the need to inherit only one copy of an
altered gene (from either the mother or the father) in order
to get MMD. Therefore, if one parent carries a genetic alteration
in the DMPK gene on chromosome 19, there is a 50% risk (or 1
in 2 risk) with each pregnancy that this alteration will be
passed on to the child, who will then be likely to develop MMD.
The genetic change that causes MMD is a repeat in the sequence
of DNA in the DMPK gene that makes the gene longer than it is
supposed to be. The specific change is called a trinucleotide
repeat, which is a CTG repeat (three DNA nucleotide bases repeated
over and over) in the genetic code. In healthy individuals,
this CTG is repeated 5 to 37 times in the DMPK gene. However,
in MMD, the CTG pattern is repeated too many times in one of
the DMPK genes (either the one inherited from the mother or
the one inherited from the father). This repeat expansion affects
the function of the protein made by the DMPK gene.
Research has shown us that the number of repeats passed on to
a child will determine if the child will get MMD, and will help
doctors to estimate the age of onset of the symptoms. The bigger
the expansion, the earlier the onset of symptoms. A genetic
mechanism called anticipation can occur in MMD. This
means that there is a tendency for the expanded CTG repeats
to expand even further when passed on to the next generation.
Anticipation is unpredictable and doesn’t always occur.
However, it has been observed in MMD. For example, if a mother
has 45 repeats in one of her DMPK genes and 6 in her other DMPK
gene, she won’t have any symptoms of MMD. However, she
may pass on the bigger DMPK gene to a daughter. The DMPK gene
may expand to have 57 repeats in the daughter, who would then
have a mild form of MMD. The bigger the expansion, the earlier
the onset of symptoms, and possibly a more severe case of MMD.
Based on observations like the above example, scientists have
been able to study the gene and make certain classifications
of the CTG repeat size:
CTG Repeat Size:
The person is healthy and MMD is not present Normal: 5-37
repeats
The person has no MMD symptoms, but his or her child is
at risk: 38-49 repeats
The person has mild MMD: 50-150 repeats
The person has classical MMD: 100-1000 or 1500 repeats
The person has congenital MMD: 1000 or more repeats
Illustration:
Every person has two number 19 chromosomes, one that
is inherited from the mother, and one from the father.
#19 inherited from Mother
|
#19 inherited from Father
|
The chromosomes are made up of the DNA sequence. This sequence
is composed of four different chemical bases called nucleotides,
represented by the letters A,T,C,G. These four bases, arranged
in different combinations, make up the genes that lie on our
chromosomes. The genes then provide the recipe for our body
to make proteins. The DMPK gene is on chromosome 19.
|
atcgatcggac
|
ctgctgctgctgctg
|
atcgatcg
|
gtccaatcg
|
gactcagt
|
| |
DMPK
gene
|
|
|
|
The above chromosome 19 has a DMPK gene with 5 CTG repeats,
which makes this gene code for healthy protein.
|
atcgatcggac
|
ctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctg
ctgctgctgctgctgctgctgctgctgctgctgctgctgctgctgctg
|
atcgatcggtccaa
|
| |
DMPK
gene
|
|
In the above chromosome 19, there are 40 CTG repeats in the
DMPK gene. This person will have not MMD symptoms, but has
the risk of passing on a DMPK gene that can expand in his
or her offspring. The more the number of repeats, the more
likely the protein will be altered and the more likely the
individual is to have MMD.
*There is another type of MMD called Myotonic Dystrophy Type
2. Less is known about this type of MMD. We do know that individuals
with type 2 will have proximal (close to the trunk of the
body) myotonic muscle disease, with other symptoms similar
to type I MMD. This type is autosomal dominant and the location
of the gene responsible for this type is found on Chromosome
3. However, the exact gene is not identified yet, and there
is no genetic testing available.
Ways a Person Gets Myotonic Muscular Dystrophy
There are two main ways that an individual can get one of the
forms of this disorder.
- Autosomal dominant forms: An affected parent who has an
altered gene can pass on this altered gene to a child. The
parent may not have symptoms of MMD because the expansion
in the gene may be small. But the expansion may grow when
it is passed on to a child.
- A genetic alteration occurred in the sperm or egg that
formed the embryo by chance. This is called a sporadic mutation.
If this occurs, then no other family members other than
the affected person’s children are not at increased
risk to get MMD. In Autosomal dominant MMD, one sporadic
mutation in one of the MMD genes would be enough to cause
the child to get MMD.
It may be that a person is the first in the family to have
MMD. This can happen if there is a new sporadic mutation that
is dominant. It also can happen if a parent carries a DMPK
gene that has 38 – 49 CTG repeats, and when this gene
was passed on to a child, the number of repeats expanded.
Other family members may be carriers of a repeat with 38-49
CTG repeats, having no disease symptoms. Therefore if one
family member is diagnosed with MMD, a genetic counselor or
physician can recommend if other family members should be
genetically tested for MMD.
Testing for and Diagnosing Myotonic Muscular Dystrophy
The first step will include your physician taking a careful
patient and family history. The doctor will ask many questions
about the patient’s siblings, parents, aunts and uncles,
grandparents and cousins. A physical examination will then be
performed, which will focus on muscle weakness and the nervous
system. The physician will look for certain signs of MMD, such
as myotonia, the characteristic long face with hollow temples,
early balding in males, abdominal pain or constipation, cataracts,
and trouble with relaxing ones grip, especially in cold weather.
It is important that an accurate diagnosis be made and to determine
whether the patient’s weakness is a result of the muscles
or nerves. If the origin of the muscle weakness cannot be determine,
some specific tests may be used, such as an electromyography
or nerve conduction study. These tests measure the electrical
activity in muscle and stimulate the nerves to see where the
problem lies.
Since there are so many types of muscle diseases, to determine
which one may be the cause of a patient’s weakness, the
physician may order a muscle biopsy. This is a minor surgical
procedure whereby a small piece of muscle from the patient
is removed, usually in the area of the thigh (quadricep) or
upper arm (deltoid). By examining this sample, doctors can
see a lot of what is happening in the muscle cells, and can
tell certain muscle disorders apart from one another. Often,
the muscle is stained with special dyes to look for the absence
or presence of proteins. Finding an abnormal protein (either
one that is not present, present in increased or decreased
amounts, or is structurally abnormal) may help determine which
gene are likely candidates responsible for the muscle problems.
Genetic Testing
There is genetic testing available for MMD. From the blood,
DNA can be isolated and scientists can read the DNA code in
the DMPK gene to see if any alterations (trinucleotide repeat
expansions) are present. When the DNA has an alteration in it,
the protein that this gene codes for may be missing or may not
function properly, which leads to muscular dystrophy. The genetic
test will look at the DMPK gene and calculate the number of
CTG repeats in this gene on both chromosome number 19’s.
It is important to note that the repeat size cannot be used
to predict the age when a person will develop symptoms or the
degree of symptom progression. We do know that the largest repeat
size is seen in congenital MMD.
There is also prenatal genetic testing available. It is possible
that symptoms of MMD may appear and be detected prior to birth
via ultrasound. These symptoms may include excess amniotic
fluid (called polyhydraminos) and decreased movement of the
unborn baby. Genetic testing during a pregnancy is most often
performed when a parent has tested positive or if pregnancy
complications develop that make physicians suspicious of congenital
MMD. A prenatal diagnosis can provide useful information for
planning the delivery and care for the child after birth.
Further, prenatal testing information can be used by parents
who can then make informed choices. Parents should speak to
a genetic counselor to discuss the options available.
Before you would consider genetic testing either for research
purposes or for clinical diagnostic testing in the future,
it is important to realize several things. The decision to
be genetically tested is a very important and personal decision.
It may affect your family life, relationships, family planning,
career and insurance decisions, and psychological and emotional
well-being. It is a decision to be carefully made and it can
have a very positive or a less positive outcome. Genetic counselors
are available to individuals who are considering genetic testing.
Genetic counseling provides useful information about the implications
of the testing and emotional support by someone with specific
training and expertise in the field. Genetic counselors also
provide information on prenatal testing for muscular dystrophies
to see if an unborn baby has inherited a genetic mutation.
This testing can be done if there is an affected relative
in the family or if the mother is known to be a carrier of
a genetic alteration in an identified gene.
Treatment and Rehabilitation of MMD
Currently there is no medication or cure available for MMD.
Treatment is limited to managing symptoms and helping affected
individuals improve their quality of life by minimizing disability.
Assistive equipment, such as a cane, braces, walkers, scooters,
or wheelchairs can help individuals with MMD remain mobile
Some individuals do not look forward to using assistive devices,
however, most users and their families find they are actually
more mobile, energetic and independent than when they have to
try walking on weak legs.
There is careful monitoring available for cardiac and respiratory
functions. Treatment is available to assist with these functions,
digestive problems, cataracts and ptosis. New medications can
treat excessive tiredness and improve the quality of life.
In the case of congenital MMD, early intervention is extremely
important. Symptoms should be investigated and diagnosed as
soon as possible so that treatment can be provided. Also, special
education should be implemented to maximize a child’s abilities.
Support
Being diagnosed yourself, or having a baby diagnosed with a
neuromuscular disorder can be overwhelming. After one is confirmed
to have myotonic dystrophy or to have a child with MMD, there
are several sources of support the patient or the family members
of the patient can seek. Please use the links below to view
support group and educational information that could benefit
a person with muscular dystrophy and/or their family.
Research
As more people participate in research for muscular dystrophy,
our knowledge of the mechanisms that cause these disorders will
improve. As our understanding of the disorders increases, we
will be better able to treat and manage these conditions. There
is research being done on muscular dystrophy and related muscular
disorders. Please visit Our
Research find out more about the research being done and
to stay informed about new advances.
Links Page
Muscular Dystrophy Association
www.mdausa.org
Muscular Dystrophy Campaign
www.muscular-dystrophy.org
Reference: Muscular Dystrophy Association
|
